|
Nihon Gene Research Laboratories
β-actin, forward 5′-gca aag acc tgt acg cca ac-3′ and reverse 5′-cta gaa gca ttt gcg gtg ga-3′ β Actin, Forward 5′ Gca Aag Acc Tgt Acg Cca Ac 3′ And Reverse 5′ Cta Gaa Gca Ttt Gcg Gtg Ga 3′, supplied by Nihon Gene Research Laboratories, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/reverse+5/pmc03372762-120-63-81?v=Nihon+Gene+Research+Laboratories Average 90 stars, based on 1 article reviews
β-actin, forward 5′-gca aag acc tgt acg cca ac-3′ and reverse 5′-cta gaa gca ttt gcg gtg ga-3′ - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
|
Shanghai GenePharma
ehhadh forward, 5'-atggctgagtatctgaggctg-3' reverse, 5'-accgtatggtccaaactagctt-3 Ehhadh Forward, 5' Atggctgagtatctgaggctg 3' Reverse, 5' Accgtatggtccaaactagctt 3, supplied by Shanghai GenePharma, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/reverse+5/pmc08112926-110-21-6?v=Shanghai+GenePharma Average 90 stars, based on 1 article reviews
ehhadh forward, 5'-atggctgagtatctgaggctg-3' reverse, 5'-accgtatggtccaaactagctt-3 - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
|
Shanghai GenePharma
caveolin-3 sirna 1, forward 5’- gugagcuacaccacuuucatt − 3’ and reverse 5’- ugaaagugguguagcucactt − 3’ Caveolin 3 Sirna 1, Forward 5’ Gugagcuacaccacuuucatt − 3’ And Reverse 5’ Ugaaagugguguagcucactt − 3’, supplied by Shanghai GenePharma, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/reverse+5/pmc09908706-41-14-6?v=Shanghai+GenePharma Average 90 stars, based on 1 article reviews
caveolin-3 sirna 1, forward 5’- gugagcuacaccacuuucatt − 3’ and reverse 5’- ugaaagugguguagcucactt − 3’ - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
|
Real Time Primers
primers for ribosomal protein l13a (rpl13a) Primers For Ribosomal Protein L13a (Rpl13a), supplied by Real Time Primers, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/reverse+5/pmc10293174-258-36-50?v=Real+Time+Primers Average 90 stars, based on 1 article reviews
primers for ribosomal protein l13a (rpl13a) - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
|
GenScript corporation
elmo3, forward 5’-accaatgggcgacgagat-3’ and reverse 5’-tgctgggttgctgttaga-3’ Elmo3, Forward 5’ Accaatgggcgacgagat 3’ And Reverse 5’ Tgctgggttgctgttaga 3’, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/reverse+5/pmc05187919-153-13-17?v=GenScript+corporation Average 90 stars, based on 1 article reviews
elmo3, forward 5’-accaatgggcgacgagat-3’ and reverse 5’-tgctgggttgctgttaga-3’ - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
|
Shenergy Group Co Ltd
p53-induced death domain-containing protein 1 (pidd) forward 5′-gggaaccagttgaacttggac-3′, reverse 5′-ctgagccgcaaaaactccac-3′ ![]() P53 Induced Death Domain Containing Protein 1 (Pidd) Forward 5′ Gggaaccagttgaacttggac 3′, Reverse 5′ Ctgagccgcaaaaactccac 3′, supplied by Shenergy Group Co Ltd, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/reverse+5/pmc07002996-58-47-38?v=Shenergy+Group+Co+Ltd Average 90 stars, based on 1 article reviews
p53-induced death domain-containing protein 1 (pidd) forward 5′-gggaaccagttgaacttggac-3′, reverse 5′-ctgagccgcaaaaactccac-3′ - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
|
Ribobio co
glut1 sirnas ![]() Glut1 Sirnas, supplied by Ribobio co, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/reverse+5/ppr0244092-64-0-11?v=Ribobio+co Average 90 stars, based on 1 article reviews
glut1 sirnas - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
|
CLC Bio
primers for wsp (forward: 5′-aac cgg gac aaa aag aag ag-3′; reverse: 5′-cag caa cct acc aaa gat gga-3′; 110-bp product) ![]() Primers For Wsp (Forward: 5′ Aac Cgg Gac Aaa Aag Aag Ag 3′; Reverse: 5′ Cag Caa Cct Acc Aaa Gat Gga 3′; 110 Bp Product), supplied by CLC Bio, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/reverse+5/pmc05395808-55-0-49?v=CLC+Bio Average 90 stars, based on 1 article reviews
primers for wsp (forward: 5′-aac cgg gac aaa aag aag ag-3′; reverse: 5′-cag caa cct acc aaa gat gga-3′; 110-bp product) - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
|
Microsynth ag
reverse: 5’- ctttctgatatcctacttatcgtcgtcatccttgtaatcaac tttttgggaaataatttctactaaagattc-3 ![]() Reverse: 5’ Ctttctgatatcctacttatcgtcgtcatccttgtaatcaac Tttttgggaaataatttctactaaagattc 3, supplied by Microsynth ag, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/reverse+5/pmc09613700__41467_2022_34088_MOESM1_ESM-55-65-69?v=Microsynth+ag Average 90 stars, based on 1 article reviews
reverse: 5’- ctttctgatatcctacttatcgtcgtcatccttgtaatcaac tttttgggaaataatttctactaaagattc-3 - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
|
MWG-Biotech ag
primers for qualitative pcr amplification of sllp1 cdna (forward: 5′-aagctctacggtcgttgtgaa ctg-3′; reverse: 5′-ctagaagtcacagccatccac cca-3′) ![]() Primers For Qualitative Pcr Amplification Of Sllp1 Cdna (Forward: 5′ Aagctctacggtcgttgtgaa Ctg 3′; Reverse: 5′ Ctagaagtcacagccatccac Cca 3′), supplied by MWG-Biotech ag, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/reverse+5/pm26088750-50-3-31?v=MWG-Biotech+ag Average 90 stars, based on 1 article reviews
primers for qualitative pcr amplification of sllp1 cdna (forward: 5′-aagctctacggtcgttgtgaa ctg-3′; reverse: 5′-ctagaagtcacagccatccac cca-3′) - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
|
Sigma-Genosys
ampc2 reverse (5 -gcttaggatatgtttggttctt ![]() Ampc2 Reverse (5 Gcttaggatatgtttggttctt, supplied by Sigma-Genosys, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/reverse+5/10__1128_slash_aac__48__4__1374___1378__2004-40-26-30?v=Sigma-Genosys Average 90 stars, based on 1 article reviews
ampc2 reverse (5 -gcttaggatatgtttggttctt - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
|
Shanghai GenePharma
caveolin-3 sirna 3, forward 5’- gcaacauuaagguggugcutt − 3’ and reverse 5’- agcaccaccuuaauguugctt − 3’ ![]() Caveolin 3 Sirna 3, Forward 5’ Gcaacauuaagguggugcutt − 3’ And Reverse 5’ Agcaccaccuuaauguugctt − 3’, supplied by Shanghai GenePharma, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/reverse+5/pmc09908706-41-42-6?v=Shanghai+GenePharma Average 90 stars, based on 1 article reviews
caveolin-3 sirna 3, forward 5’- gcaacauuaagguggugcutt − 3’ and reverse 5’- agcaccaccuuaauguugctt − 3’ - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
Image Search Results
Journal: Molecular Medicine Reports
Article Title: Phellinus gilvus -derived protocatechualdehyde induces G0/G1 phase arrest and apoptosis in murine B16-F10 cells
doi: 10.3892/mmr.2019.10896
Figure Lengend Snippet: KEGG pathway analysis of the p53 signaling pathway regulated by PCA. Copyright permission was granted by Kanehisa Laboratories to adapt a KEGG pathway map for this figure. PCA, protocatechualdehyde.
Article Snippet: An initial activation at 95°C for 2 min was followed by an amplification target sequence of 40 cycles of 95°C for 30 sec, 60°C for 30 sec and 72°C for 30 sec. PCR primers were synthesized by Shanghai
Techniques:
Journal: Molecular Medicine Reports
Article Title: Phellinus gilvus -derived protocatechualdehyde induces G0/G1 phase arrest and apoptosis in murine B16-F10 cells
doi: 10.3892/mmr.2019.10896
Figure Lengend Snippet: mRNA expression analysis of p53-related genes in B16-F10 cells treated with and without 50 µg/ml PCA for 48 h. mRNA expression level of the following genes: (A) PIDD, p21, cyclin E and Bax; and (B) cyclin D, Gadd45, p53, Bcl-2, Cdc-2, cyclin B and PIGs. Density values were normalized to GAPDH. Data are presented as the mean ± SD from three experiments per group. **P<0.01 vs. control. PCA, protocatechualdehyde; Gadd45, growth arrest and DNA damage-inducible 45; PIDD, p53-induced death domain-containing protein 1; Cdc-2, cell division cycle-associated protein 2; PIGs, phosphatidylinositol glycan anchor biosynthesis class S.
Article Snippet: An initial activation at 95°C for 2 min was followed by an amplification target sequence of 40 cycles of 95°C for 30 sec, 60°C for 30 sec and 72°C for 30 sec. PCR primers were synthesized by Shanghai
Techniques: Expressing