|
Real Time Primers
primers for ribosomal protein l13a (rpl13a) Primers For Ribosomal Protein L13a (Rpl13a), supplied by Real Time Primers, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/reverse+5/and+for+rpl13a+amplification+were++forward++5%E2%80%99+cctggaggagaagaggaaagaga+3%E2%80%99+and++reverse++5%E2%80%99+ttgaggacctctgtgtatttgtcaa+3%E2%80%99/pmc10293174-258-36-50 Average 90 stars, based on 1 article reviews
primers for ribosomal protein l13a (rpl13a) - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
|
GenScript corporation
elmo3, forward 5’-accaatgggcgacgagat-3’ and reverse 5’-tgctgggttgctgttaga-3’ Elmo3, Forward 5’ Accaatgggcgacgagat 3’ And Reverse 5’ Tgctgggttgctgttaga 3’, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/reverse+5/elmo3++forward+5%E2%80%99+accaatgggcgacgagat+3%E2%80%99+and+reverse+5%E2%80%99+tgctgggttgctgttaga+3%E2%80%99/pmc05187919-153-13-17 Average 90 stars, based on 1 article reviews
elmo3, forward 5’-accaatgggcgacgagat-3’ and reverse 5’-tgctgggttgctgttaga-3’ - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
|
Shanghai GenePharma
caveolin-3 sirna 1, forward 5’- gugagcuacaccacuuucatt − 3’ and reverse 5’- ugaaagugguguagcucactt − 3’ Caveolin 3 Sirna 1, Forward 5’ Gugagcuacaccacuuucatt − 3’ And Reverse 5’ Ugaaagugguguagcucactt − 3’, supplied by Shanghai GenePharma, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/reverse+5/caveolin+3+sirna+1++forward+5%E2%80%99++gugagcuacaccacuuucatt+++3%E2%80%99+and+reverse+5%E2%80%99++ugaaagugguguagcucactt+++3%E2%80%99/pmc09908706-41-14-6 Average 90 stars, based on 1 article reviews
caveolin-3 sirna 1, forward 5’- gugagcuacaccacuuucatt − 3’ and reverse 5’- ugaaagugguguagcucactt − 3’ - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
|
Ingenetix gmbh
specific primers for ddx3y gene (forward 5′- attggcaatcgtgaaagacc-3′ and reverse 5′- tactgccggttgcctctact-3′) ![]() Specific Primers For Ddx3y Gene (Forward 5′ Attggcaatcgtgaaagacc 3′ And Reverse 5′ Tactgccggttgcctctact 3′), supplied by Ingenetix gmbh, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/reverse+5/specific+primers+for+ddx3y+gene++forward+5+++attggcaatcgtgaaagacc+3++and+reverse+5+++tactgccggttgcctctact+3++/pmc03812163-103-11-24 Average 90 stars, based on 1 article reviews
specific primers for ddx3y gene (forward 5′- attggcaatcgtgaaagacc-3′ and reverse 5′- tactgccggttgcctctact-3′) - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
|
Shanghai GenePharma
sumo4-specific small interfering (si)rna (forward, 5′-ggaugguucuguggugcagtt-3′ and reverse, 5′-cugcaccacagaaccaucctt-3′) ![]() Sumo4 Specific Small Interfering (Si)rna (Forward, 5′ Ggaugguucuguggugcagtt 3′ And Reverse, 5′ Cugcaccacagaaccaucctt 3′), supplied by Shanghai GenePharma, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/reverse+5/sumo4+specific+small+interfering++si+rna++forward++5++ggaugguucuguggugcagtt+3++and+reverse++5++cugcaccacagaaccaucctt+3++/pmc07500055-99-3-23 Average 90 stars, based on 1 article reviews
sumo4-specific small interfering (si)rna (forward, 5′-ggaugguucuguggugcagtt-3′ and reverse, 5′-cugcaccacagaaccaucctt-3′) - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
|
Metabion International AG
oligonucleotide primers for rat mt-1 (forward 5’- caccgttgctccagattcac -3'; reverse 5'- gcagcagcactgttcgtcac – 3') ![]() Oligonucleotide Primers For Rat Mt 1 (Forward 5’ Caccgttgctccagattcac 3'; Reverse 5' Gcagcagcactgttcgtcac – 3'), supplied by Metabion International AG, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/reverse+5/oligonucleotide+primers+for+rat+mt+1++forward+5%E2%80%99++caccgttgctccagattcac++3+++reverse+5+++gcagcagcactgttcgtcac+++3++/pm28344072-94-13-44 Average 90 stars, based on 1 article reviews
oligonucleotide primers for rat mt-1 (forward 5’- caccgttgctccagattcac -3'; reverse 5'- gcagcagcactgttcgtcac – 3') - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
|
TAG Copenhagen A/S
hla reverse (5′-ggg tgc cat ata ccg ggt tc-3′) ![]() Hla Reverse (5′ Ggg Tgc Cat Ata Ccg Ggt Tc 3′), supplied by TAG Copenhagen A/S, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/reverse+5/hla+reverse++5++GGG+TGC+CAT+ATA+CCG+GGT+TC+3/pmc03280567-179-17-71 Average 90 stars, based on 1 article reviews
hla reverse (5′-ggg tgc cat ata ccg ggt tc-3′) - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
|
Sigma-Genosys
primers pn10 (5´-ttg ccg ctt cac tcg ccg tt3 ![]() Primers Pn10 (5´ Ttg Ccg Ctt Cac Tcg Ccg Tt3, supplied by Sigma-Genosys, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/reverse+5/and+the+28s+rdna+for+primer+pn10++reverse++5%C2%A2+tccgcttattgatatgcttaag+3%C2%A2+/10__4314_slash_acsj__v18i4__68647-72-24-32 Average 90 stars, based on 1 article reviews
primers pn10 (5´-ttg ccg ctt cac tcg ccg tt3 - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
|
Metabion International AG
primers for hprt ![]() Primers For Hprt, supplied by Metabion International AG, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/reverse+5/ccl22++forward++5++tct%E2%80%8Btgc%E2%80%8Btgt%E2%80%8Bggc%E2%80%8Baat%E2%80%8Btca%E2%80%8Bga+3+++reverse++5++gag%E2%80%8Bggt%E2%80%8Bgac%E2%80%8Bgga%E2%80%8Btgt%E2%80%8Bagt%E2%80%8Bcc+3++/pmc06504218-203-1-58 Average 90 stars, based on 1 article reviews
primers for hprt - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
|
Microsynth ag
tnfα (5′-gct ccc tct cat cag ttc ca-3′, 5′-gctacg ggc ttg tca ctc-3′ ![]() Tnfα (5′ Gct Ccc Tct Cat Cag Ttc Ca 3′, 5′ Gctacg Ggc Ttg Tca Ctc 3′, supplied by Microsynth ag, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/reverse+5/reverse++5%E2%80%99++cactatcagttttattaacatgctgcgctgctgctcctttgg+ctc+3/pmc08470219-62-102-115 Average 90 stars, based on 1 article reviews
tnfα (5′-gct ccc tct cat cag ttc ca-3′, 5′-gctacg ggc ttg tca ctc-3′ - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
|
Microsynth ag
0.5 μm 16s rrna primers (forward: 5’-ttgctattagatgagcctatattag-3′, reverse: 5’-gtgtggctgatcatc ctct-3′) ![]() 0.5 μm 16s Rrna Primers (Forward: 5’ Ttgctattagatgagcctatattag 3′, Reverse: 5’ Gtgtggctgatcatc Ctct 3′), supplied by Microsynth ag, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/reverse+5/0+5+%CE%BCm+16s+rrna+primers++forward++5%E2%80%99+ttgctattagatgagcctatattag+3+++reverse++5%E2%80%99+gtgtggctgatcatc+ctct+3++/pmc11293327-91-31-39 Average 90 stars, based on 1 article reviews
0.5 μm 16s rrna primers (forward: 5’-ttgctattagatgagcctatattag-3′, reverse: 5’-gtgtggctgatcatc ctct-3′) - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
|
Nihon Gene Research Laboratories
tnfsf4, forward 5′-gggatgcttctgtgcttcatct3′ and reverse 5′-tttggattggagggtcctttg-3′ ![]() Tnfsf4, Forward 5′ Gggatgcttctgtgcttcatct3′ And Reverse 5′ Tttggattggagggtcctttg 3′, supplied by Nihon Gene Research Laboratories, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/reverse+5/tnfsf4++forward+5++gggatgcttctgtgcttcatct3++and+reverse+5++tttggattggagggtcctttg+3+/pm37525585-248-12-21 Average 90 stars, based on 1 article reviews
tnfsf4, forward 5′-gggatgcttctgtgcttcatct3′ and reverse 5′-tttggattggagggtcctttg-3′ - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
Image Search Results
Journal: PLoS ONE
Article Title: The Human Placental Sexome Differs between Trophoblast Epithelium and Villous Vessel Endothelium
doi: 10.1371/journal.pone.0079233
Figure Lengend Snippet: Top 10 genes showing higher expression in male and top 10 with higher expression in female placental cell types.
Article Snippet: Specific primers for SRY (forward 5′-CTCCGGAGAAGCTCTTCCTT-3′ and reverse 5′-CAGCTGCTTGCTGATCTCTG-3′ ) and
Techniques: Expressing
Journal: PLoS ONE
Article Title: The Human Placental Sexome Differs between Trophoblast Epithelium and Villous Vessel Endothelium
doi: 10.1371/journal.pone.0079233
Figure Lengend Snippet: Validation of microarray data with RT-qPCR.
Article Snippet: Specific primers for SRY (forward 5′-CTCCGGAGAAGCTCTTCCTT-3′ and reverse 5′-CAGCTGCTTGCTGATCTCTG-3′ ) and
Techniques: Microarray
Journal: Oncology Letters
Article Title: SUMO4 small interfering RNA attenuates invasion and migration via the JAK2/STAT3 pathway in non-small cell lung cancer cells
doi: 10.3892/ol.2020.12088
Figure Lengend Snippet: SUMO4-knockdown decreases migration and invasion in NSCLC cells. SUMO4 was downregulated by siRNA in A549, H1650 and SK-MES-1 cells for analysis of its effect on migration and invasion. (A) Western blot analysis shows the expression levels of SUMO4 in the three NSCLC cell lines. (B) Western blot analysis shows the expression levels of SUMO4 and corresponding factors involved in epithelial-mesenchymal transition. (C) Cell migration was detected via the wound healing assay, magnification ×100. (D) Quantitative analysis of (C). (E) Cell invasion was assessed via the Transwell assay. (F) Quantitative analysis of (E) *P<0.05; **P<0.01; ***P<0.001. NSCLC, non-small cell lung cancer; SUMO4, small ubiquitin-like modifier 4; siRNA, small interfering RNA; NC, negative control.
Article Snippet: SUMO4-specific small interfering (
Techniques: Migration, Western Blot, Expressing, Wound Healing Assay, Transwell Assay, Small Interfering RNA, Negative Control
Journal: Oncology Letters
Article Title: SUMO4 small interfering RNA attenuates invasion and migration via the JAK2/STAT3 pathway in non-small cell lung cancer cells
doi: 10.3892/ol.2020.12088
Figure Lengend Snippet: Inhibitory effects of cisplatin on three NSCLC cell lines tested by Cell Counting Kit-8 assay. NSCLC, non-small cell lung cancer; SUMO4, small ubiquitin-like modifier 4; siRNA, small interfering RNA; NC, negative control; NC5, NSCLC cells with negative control siRNA plus 5 µM cisplatin; NC10, NSCLC cells with negative control siRNA plus 10 µM cisplatin; NC20, NSCLC cells with negative control siRNA plus 20 µM cisplatin; si5, NSCLC cells with SUMO4 siRNA plus 5 µM cisplatin; si10, NSCLC cells with SUMO4 siRNA plus 10 µM cisplatin; si20, NSCLC cells with SUMO4 siRNA plus 20 µM cisplatin.
Article Snippet: SUMO4-specific small interfering (
Techniques: Cell Counting, Small Interfering RNA, Negative Control
Journal: The Journal of Experimental Medicine
Article Title: CCL22 controls immunity by promoting regulatory T cell communication with dendritic cells in lymph nodes
doi: 10.1084/jem.20170277
Figure Lengend Snippet: CCL22 is constitutively expressed in vivo and in vitro. (A) CCL22 protein was quantified in tissue homogenates and in the serum of BALB/c mice by ELISA ( n = 5 mice) and detected by immunohistochemistry in the lymph node (LN). PP, Peyer's patches. Bar, 100 µm. (B) 10 6 freshly isolated lymph node cells and splenocytes from C57BL/6 mice were cultured, and CCL22 levels in the supernatants were determined at different time points by ELISA. (C) CCL22 mRNA expression from unsorted, CD11c-depleted (CD11c − ), or CD11c-enriched (CD11c + ) murine lymph node cells or splenocytes was determined by quantitative real-time PCR. (D) CD11b + CD8 neg , CD11b neg CD8 + , B220 + , CD103 + , and CD103 neg cells were sorted from CD11c-enriched splenocytes, and RNA was isolated followed by quantitative real-time PCR. (E) CCL22 protein level in intestinal or skin-draining lymph node tissue homogenates of C57BL/6 mice measured by ELISA ( n = 3 mice). (F) 10 5 freshly isolated CD11c + splenic DCs or 7-d differentiated BMDCs from C57BL/6 mice were cultured with or without 3 µg/ml CpG for 4 h, and CCL22 levels in the supernatants were determined by ELISA. Data are presented as mean ± SEM and are representative of two to four independent experiments ( n = 3–5 mice per group). ***, P < 0.001 (two-sided Student’s t test).
Article Snippet: The
Techniques: In Vivo, In Vitro, Enzyme-linked Immunosorbent Assay, Immunohistochemistry, Isolation, Cell Culture, Expressing, Real-time Polymerase Chain Reaction
Journal: The Journal of Experimental Medicine
Article Title: CCL22 controls immunity by promoting regulatory T cell communication with dendritic cells in lymph nodes
doi: 10.1084/jem.20170277
Figure Lengend Snippet: CCL22 mediates DC–T reg contacts. (A) T convs (green) and T regs (red) from OT-II mice were mixed at a 1:1 ratio and cultured with unlabeled Ccl22 −/− or C57BL/6 WT CD11c + splenic DCs in the presence of 1 µg/ml OVA 323–339 peptide. After 12 h, cells were imaged by confocal microscopy (representative images are shown; bars, 15 µm), and the ratio of T regs to T convs per DC cluster was determined. (B) 10 6 T convs or T regs (both red) from C57BL/6 mice were mixed in a collagen gel with 10 5 BMDCs (green) from Ccl22 −/− or WT mice, and DC–T cell interaction was analyzed by confocal microscopy over 8 h. Resulting videos were analyzed for DC–T cell contacts by a computer algorithm. Left: One dot represents the percentage of DCs in contact with T cells at one time point. Right: Triplicates of the respective conditions were cocultured in parallel. One dot represents the mean percentage of DCs in contact with T cells over the total culture time. (C) BMDCs were treated with either control or CCL22 siRNA and, as in B, mixed with T regs, and DC–T cell interaction was quantified. (D) DC–T cell interaction was analyzed and depicted as in B, and DC2.4-CCL22 dox cells in which CCL22 is inducible by doxycycline (Dox) were used. (E) Differently labeled OVA 323–339 -pulsed BMDCs were pretreated with control or CCL22 siRNA 18 h before injection into the footpad of OT-II-Foxp3-GFP mice. The footpad-draining lymph node was imaged by two-photon microscopy (a representative image of a 1-h video is shown; bar, 30 µm), and the number of OT-II-Foxp3 + –T reg contacts with DCs per hour as well as the contact time for each T reg–DC contact was quantified by two blinded independent investigators. 15 control DCs and 16 CCL22 knockdown DCs were examined. The instantaneous velocities were calculated from manually tracked cells using Imaris. All in vitro data are representative of three and all in vivo data of two independent experiments. Data are shown as mean ± SEM. *, P < 0.05; **, P < 0.01; ***, P < 0.001; ns, not significant (two-sided Student’s t test).
Article Snippet: The
Techniques: Cell Culture, Confocal Microscopy, Control, Labeling, Injection, Microscopy, Knockdown, In Vitro, In Vivo
Journal: The Journal of Experimental Medicine
Article Title: CCL22 controls immunity by promoting regulatory T cell communication with dendritic cells in lymph nodes
doi: 10.1084/jem.20170277
Figure Lengend Snippet: Ccl22 −/− mice have excessive T cell responses upon vaccination. Ccl22 −/− and WT C57BL/6 mice were injected with OVA protein two times at a 7-d interval, and CpG together with Alum were used as adjuvant. (A and B) 1 wk after the last injection, the frequency of OVA-specific cytotoxic T cells (CD19 neg CD3 + CD8 + ) in the peripheral blood was determined by pentamer (H-2Kb OVA 257–264 ) staining (A) and intracellular IFN-γ staining (B) upon restimulation with OVA 257–264 peptide ( n = 11 mice per group treated with OVA and n = 4 mice per group without treatment). Data are shown as mean ± SEM and are pooled from two independent experiments. In total, three experiments with similar results were performed. **, P < 0.01 (two-sided Student’s t test).
Article Snippet: The
Techniques: Injection, Adjuvant, Staining
Journal: The Journal of Experimental Medicine
Article Title: CCL22 controls immunity by promoting regulatory T cell communication with dendritic cells in lymph nodes
doi: 10.1084/jem.20170277
Figure Lengend Snippet: CCL22-deficient DCs strongly increase T cell immunity. (A) OVA 257–264 -pulsed Ccl22 −/− or WT DCs were injected into C57BL/6 WT mice three times every 14 d, and CpG together with Alum were used as adjuvant ( n = 15 mice per group injected with DCs and n = 4 mice without treatment). The frequency of splenic OVA-specific cytotoxic T cells was determined by pentamer (left) and intracellular IFN-γ staining (right) as described in 1 wk after the last injection. Data are shown as mean ± SEM and are pooled from two independent experiments. In total, four experiments with similar results were performed. (B) OVA 257–264 -pulsed Ccl22 −/− or WT DCs were injected into either Ccr4 −/− or WT recipient mice. The experiment was performed as described in A ( n = 7 mice per group injected with DCs and n = 2 mice per group without treatment). Data are shown as mean ± SEM and are representative of two independent experiments. *, P < 0.05; **, P < 0.01; ***, P < 0.001 (two-sided Student’s t test).
Article Snippet: The
Techniques: Injection, Adjuvant, Staining
Journal: The Journal of Experimental Medicine
Article Title: CCL22 controls immunity by promoting regulatory T cell communication with dendritic cells in lymph nodes
doi: 10.1084/jem.20170277
Figure Lengend Snippet: Vaccination against tumors is more efficient in Ccl22 −/− mice. (A and B) Ccl22 −/− and WT C57BL/6 mice were injected subcutaneously with Panc02-OVA tumors. 1 wk after tumor induction, mice were vaccinated twice with OVA at a 7-d interval as described in , and tumor size as well as survival was monitored ( n = 14 mice per group). Growth curves are depicted up to the time point of >20% deaths in one group. Data are shown as mean ± SEM and are pooled from two independent experiments. In total three experiments with similar results were performed. (C) 1 wk after the last vaccination, OVA-specific T cells in the peripheral blood of the mice ( n = 8, one of three experiments with similar results) were determined as described in . Data are shown as mean ± SE. *, P < 0.05; **, P < 0.01; ***, P < 0.001 (two-sided Student’s t test and two-way ANOVA).
Article Snippet: The
Techniques: Injection
Journal: The Journal of Experimental Medicine
Article Title: CCL22 controls immunity by promoting regulatory T cell communication with dendritic cells in lymph nodes
doi: 10.1084/jem.20170277
Figure Lengend Snippet: Ccl22 -deficient mice are highly susceptible to DSS-induced colitis. Ccl22 −/− and WT C57BL/6 mice were fed with or without 0.5% DSS dissolved in tap water over a period of 1 wk followed by 1 wk of recreation, in three consecutive cycles. Disease severity was analyzed at day 7 after the last cycle of DSS administration. (A) Loss of body weight, diarrhea, and the presence of occult or overt blood in the stool was used to determine the clinical disease activity index (DAI). (B–D) The colon length was measured (B) and tissue sections of the colon were analyzed for mononuclear and neutrophilic cell infiltration, crypt hyperplasia, epithelial injury, and crypt abscesses (C and D) to determine the histological score (bars, 200 µm). Data are shown as mean ± SEM of five mice per group and are representative of three independent experiments. ***, P < 0.001 (two-sided Student’s t test).
Article Snippet: The
Techniques: Activity Assay
Journal: Frontiers in Microbiology
Article Title: In vitro extracellular replication of Wolbachia endobacteria
doi: 10.3389/fmicb.2024.1405287
Figure Lengend Snippet: Isolated Wolbachia replicate in medium when the C6/36 cell membranes are retained. Wolbachia were purified from C6/36 cells via ultracentrifugation , or were purified by an abbreviated protocol that retained more of the insect cell lysate. Cell-free cultures were incubated at 26°C for 15 days and samples were taken every one to three days. Wolbachia were quantified by qPCR of the 16S rRNA gene. Copy numbers were normalized to day 0. Data were pooled from two independent experiments. For days 2, 4, 6 (experiment 1) and days 9, 11, 15 (experiment 2), the data from only one experiment is shown. For the other days, the mean ± SEM of 2–5 wells is shown.
Article Snippet: A qPCR reaction contained 1x HotStar Taq polymerase buffer, 3 mM MgCl 2 , 200 μM dNTPs, 0.2 μL SYBR Green (1,000-fold diluted in DMSO; Fermentas, St. Leon-Rot, Germany), 0.5 μM
Techniques: Isolation, Purification, Incubation
Journal: Frontiers in Microbiology
Article Title: In vitro extracellular replication of Wolbachia endobacteria
doi: 10.3389/fmicb.2024.1405287
Figure Lengend Snippet: Wolbachia replication in cell-free culture is dose-dependent on the amount of C6/36 cell lysate. Total cell lysate from uninfected C6/36 cells was prepared from the depicted cell numbers determined in a Neubauer counting chamber prior to cell lysis. Purified Wolbachia (0.5–1.5 × 10 3 16S rRNA gene copies/μL) were incubated at 26°C for 12 days with the three indicated dilutions of insect cell lysate. Growth was monitored by 16S rRNA gene qPCR every three days and data were normalized to day 0. Data were pooled from two independent experiments. For every time point, the mean ± SEM of six wells is shown.
Article Snippet: A qPCR reaction contained 1x HotStar Taq polymerase buffer, 3 mM MgCl 2 , 200 μM dNTPs, 0.2 μL SYBR Green (1,000-fold diluted in DMSO; Fermentas, St. Leon-Rot, Germany), 0.5 μM
Techniques: Lysis, Purification, Incubation
Journal: Frontiers in Microbiology
Article Title: In vitro extracellular replication of Wolbachia endobacteria
doi: 10.3389/fmicb.2024.1405287
Figure Lengend Snippet: Starting density of Wolbachia influences cell-free replication. Different starting concentrations of Wolbachia were incubated with total insect cell lysate (equivalent to 0.95 × 10 6 uninfected C6/36 cells) at 26°C for 12 days. Growth was monitored by 16S rRNA gene qPCR every three days and data were normalized to day 0. The graph is representative of two independent experiments. For every time point, the mean ± SEM of three wells is shown.
Article Snippet: A qPCR reaction contained 1x HotStar Taq polymerase buffer, 3 mM MgCl 2 , 200 μM dNTPs, 0.2 μL SYBR Green (1,000-fold diluted in DMSO; Fermentas, St. Leon-Rot, Germany), 0.5 μM
Techniques: Incubation
Journal: Frontiers in Microbiology
Article Title: In vitro extracellular replication of Wolbachia endobacteria
doi: 10.3389/fmicb.2024.1405287
Figure Lengend Snippet: The cell membrane-containing fraction from C6/36 cells is required for Wolbachia replication in a cell-free culture. Total cell lysate was prepared from 0.95 × 10 6 uninfected C6/36 cells. A portion of cell lysate was fractionated by centrifugation at 20,000 g for 30 min or 100,000 g for 60 min. Wolbachia were incubated in the supernatant retained after 20,000 g centrifugation (Fraction 1, microsomes and membranes), the corresponding pellet resuspended in cell culture medium (Fraction 2, nuclear debris and organelles), or the supernatant retained after 100,000 g (Fraction 3, soluble cytoplasmic molecules) at 26°C for 12 days. Growth was compared to reactions containing total insect cell lysate or medium alone. The initial concentration of Wolbachia was 10 3 16S rRNA gene copies/μL. Growth was monitored by 16S rRNA gene qPCR every three days and data were normalized to day 0. Data were pooled from two independent experiments. For every time point, the mean ± SEM of six wells is shown, except for the medium group for which the mean ± SEM of three wells is shown.
Article Snippet: A qPCR reaction contained 1x HotStar Taq polymerase buffer, 3 mM MgCl 2 , 200 μM dNTPs, 0.2 μL SYBR Green (1,000-fold diluted in DMSO; Fermentas, St. Leon-Rot, Germany), 0.5 μM
Techniques: Membrane, Centrifugation, Incubation, Cell Culture, Concentration Assay
Journal: Frontiers in Microbiology
Article Title: In vitro extracellular replication of Wolbachia endobacteria
doi: 10.3389/fmicb.2024.1405287
Figure Lengend Snippet: Addition of fresh Fraction 1 or cholesterol do not support cell-free replication. (A) Cell-free Wolbachia (2 × 10 2 16S rRNA gene copies/μL) were incubated with Fraction 1 from uninfected C6/36 cells (equivalent to 0.95 × 10 6 cells/mL) at 26°C for 15 days. On day 9, fresh Fraction 1 was added to half of the remaining wells. Growth was monitored by 16S rRNA gene qPCR every three days and data were normalized to day 0. The graph is representative of two independent experiments. For every time point, the mean ± SEM of three wells is shown. (B) Cell-free Wolbachia (0.5 × 10 3 16S rRNA gene copies/μL) were incubated with Fraction 1 from uninfected C6/36 cells (equivalent to 0.95 × 10 6 cells/mL) with or without water-soluble cholesterol (0.1 or 1 mg/mL) at 26°C for 12 days. Growth was monitored by 16S rRNA gene qPCR every three days and data were normalized to day 0. For every time point, the mean ± SEM of six wells is shown.
Article Snippet: A qPCR reaction contained 1x HotStar Taq polymerase buffer, 3 mM MgCl 2 , 200 μM dNTPs, 0.2 μL SYBR Green (1,000-fold diluted in DMSO; Fermentas, St. Leon-Rot, Germany), 0.5 μM
Techniques: Incubation
Journal: Frontiers in Microbiology
Article Title: In vitro extracellular replication of Wolbachia endobacteria
doi: 10.3389/fmicb.2024.1405287
Figure Lengend Snippet: FBS is required for Wolbachia replication in a cell-free culture. Cell-free Wolbachia (0.1–1 × 10 4 16S rRNA gene copies/μL) were incubated with Fraction 1 from uninfected C6/36 cells (equivalent to 0.95 × 10 6 cells/mL) harvested in cell culture medium either with or without FBS and incubated at 26°C for 12 days. Growth was monitored by 16S rRNA gene qPCR every three days and data were normalized to day 0. Data were pooled from two independent experiments. For every time point, the mean ± SEM of six wells is shown.
Article Snippet: A qPCR reaction contained 1x HotStar Taq polymerase buffer, 3 mM MgCl 2 , 200 μM dNTPs, 0.2 μL SYBR Green (1,000-fold diluted in DMSO; Fermentas, St. Leon-Rot, Germany), 0.5 μM
Techniques: Incubation, Cell Culture
Journal: Frontiers in Microbiology
Article Title: In vitro extracellular replication of Wolbachia endobacteria
doi: 10.3389/fmicb.2024.1405287
Figure Lengend Snippet: Cell-free cultured Wolbachia infect uninfected C6/36 cells. (A) Cell-free Wolbachia (0.5 × 10 3 16S rRNA gene copies/μL) were incubated with Fraction 1 from uninfected C6/36 cells (equivalent to 0.95 × 10 6 cells/mL) at 26°C for 12 days. Growth was monitored by 16S rRNA gene qPCR every three days. For every time point, the mean ± SEM of three wells is shown. (B) On day 12, 750 μL of this cell-free Wolbachia culture were added to uninfected C6/36 cells grown in a 24-well plate. As a negative control, Wolbachia were heat-killed at 95°C for 10 min prior to addition to the uninfected C6/36 cells. After centrifugation at 2,000 g for 1 h at 15°C, the plate was incubated overnight at 26°C. On the next day, the medium was removed and fresh cell culture medium was added. On day 6 post-infection, three samples were taken for 16S rRNA gene qPCR of C6/36 cells infected with Wolbachia and with heat-killed Wolbachia (mean ± SEM). Data are representative of two experiments. (C) Six days post-infection, C6/36 cells were grown on culture slides for 1 day and subsequently examined with a Zeiss Axio Observer.Z1 fluorescence microscope using immunofluorescence microscopy with w PAL anti-serum and an Alexa 488-conjugated secondary antibody (green, Wolbachia ) and counterstained with DAPI (blue). Scale bar: 5 μm.
Article Snippet: A qPCR reaction contained 1x HotStar Taq polymerase buffer, 3 mM MgCl 2 , 200 μM dNTPs, 0.2 μL SYBR Green (1,000-fold diluted in DMSO; Fermentas, St. Leon-Rot, Germany), 0.5 μM
Techniques: Cell Culture, Incubation, Negative Control, Centrifugation, Infection, Fluorescence, Microscopy, Immunofluorescence
Journal: Frontiers in Microbiology
Article Title: In vitro extracellular replication of Wolbachia endobacteria
doi: 10.3389/fmicb.2024.1405287
Figure Lengend Snippet: Variation in growth between Wolbachia cultured in cell-free medium ± Fraction 1 from C6/36 cell lysate compared to standard C6/36 cell culture. The replication of Wolbachia in cell-free culture with and without Fraction 1 from insect cell lysate or in C6/36 cells was compared on day 9, combining data from at least 20 independent experiments performed in duplicates (growth in C6/36 cells) or triplicates (cell-free growth), respectively. Cell-free Wolbachia with initial concentrations of 10 2 –10 3 16S rRNA gene copies/μL were incubated with Fraction 1 from uninfected C6/36 cells (equivalent to 0.95 × 10 6 cells/mL). Wolbachia in C6/36 cells had initial concentrations of 10 3 –10 4 16S rRNA gene copies/μL. Each dot represents one experiment. The median with interquartile range is shown (red lines). Statistical differences were determined using a Kruskal-Wallis test followed by a post-hoc Dunn’s multiple comparisons test using GraphPad Prism 10.
Article Snippet: A qPCR reaction contained 1x HotStar Taq polymerase buffer, 3 mM MgCl 2 , 200 μM dNTPs, 0.2 μL SYBR Green (1,000-fold diluted in DMSO; Fermentas, St. Leon-Rot, Germany), 0.5 μM
Techniques: Cell Culture, Incubation
Journal: Frontiers in Microbiology
Article Title: In vitro extracellular replication of Wolbachia endobacteria
doi: 10.3389/fmicb.2024.1405287
Figure Lengend Snippet: Cell-free cultured Wolbachia are sensitive to fosfomycin treatment. Cell-free Wolbachia (0.5 × 10 3 16S rRNA gene copies/μL) were incubated with Fraction 1 from uninfected C6/36 cells (equivalent to 0.95 × 10 6 cells/mL) at 26°C for 12 days, with or without daily 512 μg/mL fosfomycin treatment. (A) Cells were fixed and visualized by immunofluorescence microscopy using w PAL anti-serum and an Alexa 488-conjugated secondary antibody (green, Wolbachia ) and counterstained with DAPI (blue). Scale bar: 5 μm. (B) Cell diameter (median with IQR, red lines) was measured with ImageJ based on the w Pal staining from three independent assays ( n = 22). Statistical differences were determined using a Mann–Whitney test using GraphPad Prism 10.
Article Snippet: A qPCR reaction contained 1x HotStar Taq polymerase buffer, 3 mM MgCl 2 , 200 μM dNTPs, 0.2 μL SYBR Green (1,000-fold diluted in DMSO; Fermentas, St. Leon-Rot, Germany), 0.5 μM
Techniques: Cell Culture, Incubation, Immunofluorescence, Microscopy, Staining, MANN-WHITNEY